Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • Home
  • SEARCH
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 493821
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 13, 20262026-05-13T05:26:28+00:00 2026-05-13T05:26:28+00:00

I am trying to get a DIV element to wrap its content despite the

  • 0

I am trying to get a DIV element to wrap its content despite the content not having any whitespace. The content is a nucleic acid sequence, so inserting whitespace every x-characters is possible, but I’d rather do it more elegantly if possible.

e.g.

 <div>TCTTGCTGCGCCTCCGCCTCCTCCTCTGCTCCGCCACCGGCTTCCTCCTCCTGAGCAGTCAGCCCGCGCGCCGGCCGGCTCCGTTATGGCGACCCGCAGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCGGCCCTGGCCGGTTCAGGCCCACGCGGCAGGTGGCGGCCGGGCCCTGAGGCGCGGGATCCGCAGTGCGGGCTCGGGCGGCCGGGCCCAGGGAACCCCGCAGGCGGGGGCGGCCAGTTTCCCGGGTTCGGCTTTACGTCACGCGAGGGCGGCAGGGAGGACGGAATGGCGGGGTTTGGGGTGGGTCCCTCCTCGGGGGAGCCCTGGGAAAAGAGGACTGCGTGTGGGAAGAGAAGGTGGAAATGGCGTTTTGGTTGACATGTGCCGCCTGCGAGCGTGCTGCGGGGAGGGGCCGAGGGCAGATTCGGGAATGATGGCGCGGGGTGGGGGCGTGGGGGCTTTCTCGGGAGAGGCCCTTCCCTGGAAGTTTGGGGTGCGATGGTGAGGTTCTCGGGGCACCTCTGGAGGGGCCTCGGCACGGAAAGCGACCACCTGGGAGGGCGTGTGGGGACCAGGTTTTGCCTTTAGTTTTGCACACACTGTAGTTCATCTTTATGGAGATGCTCATGGCCTCATTGAAGCCCCACTACAGCTCTGGTAGCGGTAACCATGCGTATTTGACACACGAAGGAACTAGGGAAAAGGCATTAGGTCATTTCAAGCCGAAATTCACATGTGCTAGAATCCAGATTCCATGCTGACCGATGCCCCAGGATATAGAAAATGAGAATCTGGTCCTTACCTTCAAGAACATTCTTAACCGTAATCAGCCTCTGGTATCTTAGCTCCACCCTCACTGGTTTTTTCTTGTTTGTTGAACCGGCCAAGCTGCTGGCCTCCCTCCTCAACCGTTCTGATCATGCTTGCTAAAATAGTCAAAACCCCGGCCAGTTAAATATGCTTTAGCCTGCTTTATTATGATTATTTTTGTTGTTTTGGCAATGACCTGGTTACCTGTTGTTTCTCCCACTAAAACTTTTTAAGGGCAGGAATCACCGCCGTAACTCTAGCACTTAGCACAGTA</div>

I need not support every browser. I’m mainly interested in Chrome, Safari and Firefox and other standards-compliant browsers.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-13T05:26:28+00:00Added an answer on May 13, 2026 at 5:26 am

    CSS style like this will help:

    word-wrap:break-word

    Other CSS settings that control wrapping are described here.

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

IM trying to get the div content not to flow past the footer, I
I'm trying to get a DIV element into a table cell, in a way
I have a DIV with element id; e.g. bgjhkn2n2-20. I'm trying to get the
I'm trying to get each letter in a div element to change to a
I'm trying to get all the children of a div element (code below) in
I'm trying to get the CSS background-color of a div-element I'm clicking on. Now
I'm trying to get all the found elements within a <div> , but by
So i am trying get 2 div-containers which both should contain centered text (Both
HI I am trying to get div from getelementbyid but it isnt working for
I'm trying to get a div to fade in using jquery, when the mouse

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.