Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 242501
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 11, 20262026-05-11T20:50:34+00:00 2026-05-11T20:50:34+00:00

I am working of a file preparation software to enable translators work easily and

  • 0

I am working of a file preparation software to enable translators work easily and efficiently on a wide range of file formats.

As far as text-based formats (xml, php, resource files,…) are concerned, my small preparation utility works fine, but a major problem for most translators is to handle all kinds of proprietary binary formats (Framemaker, Publisher, Quark…).

These files are rarely requested and need to be opened in expensive applications (few freelance can afford to buy $20,000 worth of software just to handle a few projects per year), and even then it is not convenient to work directly in those applications anyway.

I would like to be able to read these files and extract the text in such a way that it can be translated and then re-imported in the original application with minimal effort, or even better, to recreate a valid native binary file.

Does that sound doable?

Where can I find more information on handling binary file formats and are there useful tools for these kind of jobs (besides regular hex editors)?

Thanks in advance.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-11T20:50:35+00:00Added an answer on May 11, 2026 at 8:50 pm

    Of course reverse engineering is possible, but without format specs it will take a lot of work. I would look at the return on effort regarding supporting these ‘rarely requested, very expensive’ formats. You may be better off spending that effort improving the core functionality of your app.

    Another angle is to contact the companies with these formats, explain your goal, explain that it helps their product, and if they don’t see you as competition they might be willing to help.

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have jquery multi-file working as shown in link text . However, what I
I have a working file rename java tool, now I want to add an
Am working on file / folder event capturing of OS X 10.5 and 10.6
On whatever reason this is not working (says 'file not found'), set in=c:\myprogram\_save cd
This is my first time working with file i/o in java, and it's not
I working on adding file uploading to my web application. I'm using an iframe
I am working on pom file modifications to change the version node value. I
I'm working on a file format that should be written and read in several
I am working with a file (fasta file), here is the format- >chr1 AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGC
I am currently working with a file name and I need to get the

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.