Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • Home
  • SEARCH
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 3215122
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 17, 20262026-05-17T15:08:27+00:00 2026-05-17T15:08:27+00:00

I am working on a file where the my current commit ended up being

  • 0

I am working on a file where the my current commit ended up being bad and I want to go back to earlier commits for a specific file?

I did a search it looks like no one has answered a similar question (how to roll back changes in a file in a previous commit in git)….

Hopefully a simple answer?

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-17T15:08:28+00:00Added an answer on May 17, 2026 at 3:08 pm
    git checkout <commit-id> file(s)
    

    It will overwrite easily so beware with your file wildcards, which do can cover several files at once. For help, you can check out the git log messages with the wanted files as a filter:

    git log <file>
    

    Will show only those commits with log messages that involve the <file> searched.

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

Say the path of the file 'file1.txt' is /home/bentley4/Desktop/sc/file1.txt Say my current working directory
I have a working file rename java tool, now I want to add an
Am working on file / folder event capturing of OS X 10.5 and 10.6
On whatever reason this is not working (says 'file not found'), set in=c:\myprogram\_save cd
This is my first time working with file i/o in java, and it's not
I working on adding file uploading to my web application. I'm using an iframe
I am working on pom file modifications to change the version node value. I
I'm working on a file format that should be written and read in several
I am working with a file (fasta file), here is the format- >chr1 AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGC
I am currently working with a file name and I need to get the

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.