Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • Home
  • SEARCH
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 8185797
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: June 7, 20262026-06-07T01:58:23+00:00 2026-06-07T01:58:23+00:00

I found that if my fasta file ends with a single line sequence then

  • 0

I found that if my fasta file ends with a single line sequence then that sequence returned by Bioperl will have one nucleotide missing. If fasta file ends with the new line then it returns complete sequence. Don’t understand why? Is this a requirement for fasta files to end with an empty new line?

This the code I am using

my $obj    = $db->get_Seq_by_id($id);
my $seq    = $obj->seq; # returns 36 or 35 nucleotides depending if last new line exists 
my $length = $obj->length; # returns 36 or 35

And the fasta sequence:

gi|37423|emb|X04588.1| Human 2.5 kb mRNA for cytoskeletal tropomyosin TM30(nm)
CCCTTTAAATTTCCCTTTAAATTTCCCTTTAAATTTT

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-06-07T01:58:25+00:00Added an answer on June 7, 2026 at 1:58 am

    You should check that your fasta file has an even number of lines: wc -l file.fasta.

    It is a requirement that for each line in your fasta file, there must be an end of current line character: $. If you use the vi editor, type :set list to reveal these hidden characters. Alternatively, try: cat -A file.fasta to see the line endings.

    Also, to be a true fasta file, your header line should begin with the > character.


    Perhaps it’s not so much the evenness of lines, but rather if the last line in the file contains a newline ending. If this:

    cat -A fasta.file | awk 'END { print substr ($0, length, 1) }'
    

    does not return a dollar sign ($), then you may have problems using your fasta file.


    To replicate the problem, you can remove the last newline character from a ‘good’ (even lined) fasta file with this:

    perl -i -pe 'chomp if eof' fasta.file
    

    And you can add a newline to the end of your file with this:

    perl -i -ne 'chomp; print "$_\n"' fasta.file
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I found that, WebView control (For Windows 8 Metro style app) is the one
I found that most tutorials use one big router. For example: https://github.com/thomasdavis/backboneboilerplate/blob/gh-pages/js/router.js Wouldn't it
I found that using Smarty with PHP, sometimes extra time will need to be
I found that I have to perform a swap in python and I write
i have a simple program that sorts a text file according to length of
I have not yet found an easy solution to copy your file to a
I have the problem that Tomcat 7 is terribly slow on startup. I found
My overall problem is that I have a large Excel file(Column A-S, 85000 rows)
I found that HTMLOptionsCollection object inherits properties and methods from HTMLCollection. HTMLOptionsCollections->HTMLCollection->Object->null Is there
I found that when I use HttpWebRequest to establish SSL\TLS connection, it takes near

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.