Question

I had posted before a question related to this, but the solutions didn´t solve completely my problem.

I have a table that contains the characters “‘”, and “#” and when I read it using read.table() to read it and it cannot skip the rows that contain those characters.

I am reading the file using the command:

table<- read.table("table.txt",header =TRUE, sep ="\t",quote="'",skip=8,fill=TRUE, comment.char="#",check.names=F)

This is only reading the first column of the table and not the entire table like it was supposed to do, any suggestions how to solve this?

An example line of the table containing # is:

Homo sapiens    Unigene Hs.549823   ILMN_110080 HS.549823   Hs.549823       Hs.549823       5053715 AI732602            ILMN_1846799    5910129 S   320 GCAGGTTGTTATTGTTGCTGAGCGGGGTGTGTGGGTGGCTAACGAGAGGG  11  +   61276241-61276290       zo26g12.x5 Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:588070 3, mRNA sequence

Answer 1

Try using readLines() instead to get the raw lines, then splice them according to your delimiter

library(stringr)

# Open Connection to file
pathToFile <- path.expand("~/path/to/file/myfile.txt")
f <- file(pathToFile, "rb")  

# Read in lines
rawText <- readLines(f)

problemFreeTable <- 
  sapply(rawText, str_split, "\t")  # replace "\t" with "," or the appropriate delim.