Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • Home
  • SEARCH
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 8572087
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: June 11, 20262026-06-11T18:55:39+00:00 2026-06-11T18:55:39+00:00

I have a FASTA file with an alignment of multiple gene samples. I am

  • 0

I have a FASTA file with an alignment of multiple gene samples. I am trying to develop a program that can count the number of mutations for each sample. What’s the best way to do this? Store each gene sample in a dictionary and compare them somehow?

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-06-11T18:55:40+00:00Added an answer on June 11, 2026 at 6:55 pm

    If they are in an alignment format already, the identities and mismatches are already calculated. So you have something like this:

    Aln1: ACTGGTTGTCCAACCGTAATCGAAG

    Aln2: —GGTTGTCCAATTC—TCGAAG

    Capture each one into a string, and simply enumerate over them.
    Something simple like this works:

    mutations=0
    for i,j in zip(aln1,aln2):
        if i != j and i != '-' and j != '-':
            mutations+=1
    

    It depends on your personal criteria though, if you want to include gaps as mutations, etc.

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have program that runs fast enough. I want to see the number of
The problem : I have multiple parallel processes that handle flat file records .
I have a FASTA file with a large number of entries. Although all of
I have a program that creates an array of hashes while parsing a FASTA
I have read that CURL is way too fast than File Get Contents and
I have a FASTA file containing several protein sequences. The format is like ----------------------
I have a file File1 that contains these data : NC_009066 5239 5308 trnA(tgc)
Suppose from index.py with CGI, I have post file foo.fasta to display file. I
So I have a file that looks like so: #!/usr/bin/python import MySQLdb import subprocess
I read in a text file that is tab delimited, i then have a

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.