Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 8222301
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: June 7, 20262026-06-07T14:13:53+00:00 2026-06-07T14:13:53+00:00

I have a file in rows as below and would like to convert into

  • 0

I have a file in rows as below and would like to convert into two column format.

>00000_x1688514
TGCTTGGACTACATATGGTTGAGGGTTGTA
>00001_x238968
TGCTTGGACTACATATTGTTGAGGGTTGTA
...

Desired output is

>00000_x1688514 TGCTTGGACTACATATGGTTGAGGGTTGTA
>00001_x238968 TGCTTGGACTACATATTGTTGAGGGTTGTA
...

I would appreciate any help. Thanks.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-06-07T14:13:55+00:00Added an answer on June 7, 2026 at 2:13 pm

    I don’t know if you are aware of the BioPerl modules for reading/writing and other genetic functions. Your problem can be written like this.

    #!/usr/bin/perl
    use strict;
    use warnings;
    use Bio::SeqIO;
    
    my $file = 'o33.txt';
    my $in  = Bio::SeqIO->new( -file   =>  $file,
                               -format => 'fasta');
    
    while ( my $seq = $in->next_seq() ) {
        print $seq->id, "\t", $seq->seq, "\n";
    }
    
    __END__
    00000_x1688514  TGCTTGGACTACATATGGTTGAGGGTTGTA
    00001_x238968   TGCTTGGACTACATATTGTTGAGGGTTGTA
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have a two huge text files whose format is as below. File 1:
I have an excel file with 10,000 rows in column A some values are
I have an excel file (that I use as a template) with two rows.
I would like to rename a large number of columns (column headers) to have
I have a really long 3 column table. I would like to <table> <tr><td>Column1</td><td>Column2</td></tr>
I have a txt file containing multiple rows of identical size: (Examples) 0123456 789
Little Background: I have csv file which has lots of rows and each row
I have a data file which is comprised of rows of data, newline separated.
I have a csv file which may have empty or blank rows. I want
I have a Unicode file (UTF-16 FFFE little-endian BOM) which contains rows of tab-separated

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.