Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 8567583
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: June 11, 20262026-06-11T17:54:57+00:00 2026-06-11T17:54:57+00:00

I have a large file in this format: >Abc1 | SOME TEXT atgcgnntcagacagacaa >Abc2

  • 0

I have a large file in this format:

>Abc1 | SOME TEXT

atgcgnntcagacagacaa

>Abc2 | SOME DIFFERENT TEXT

nnatgcgatgacatacanggaaga

>Abc3 | SOME OTHER TEXT

gcatgacagagacagatgacaggcacacg

All I am trying to do is change the case of line not starting with ‘>Abc’. Simple it seems but I do not know why it is not working:

sed -n '/^>/! y/atgcn/ATGCN/' sequence.fa > test2

I would appreciate your help.

AK

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-06-11T17:54:58+00:00Added an answer on June 11, 2026 at 5:54 pm

    Remove the -n switch from the command

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have a large text file I need to sort in Java. The format
I have a large text file that contains data in the following format: AUTHOR:
I have a fairly large Excel file. In this file there is a column
I have a large xml file that looks like this: 20120124 07:30:15.301, saving to
I have this string in serialize format a:6:{s:5:width;i:452;s:6:height;i:336;s:14:hwstring_small;s:23:height='96' width='128';s:4:file;s:20:2012/01/Picture3_410_1325761656.jpg;s:5:sizes;a:8:{s:9:thumbnail;a:3:{s:4:file;s:35:Picture3_410_1325761656-162x160.jpg;s:5:width;i:162;s:6:height;i:160;}s:6:medium;a:3:{s:4:file;s:35:Picture3_410_1325761656-258x191.jpg;s:5:width;i:258;s:6:height;i:191;}s:8:post-top;a:3:{s:4:file;s:35:Picture3_410_1325761656-110x110.jpg;s:5:width;i:110;s:6:height;i:110;}s:9:post-tiny;a:3:{s:4:file;s:35:Picture3_410_1325761656-108x100.jpg;s:5:width;i:108;s:6:height;i:100;}s:9:post-item;a:3:{s:4:file;s:35:Picture3_410_1325761656-452x327.jpg;s:5:width;i:452;s:6:height;i:327;}s:11:post-review;a:3:{s:4:file;s:35:Picture3_410_1325761656-162x166.jpg;s:5:width;i:162;s:6:height;i:166;}s:9:post-poll;a:3:{s:4:file;s:35:Picture3_410_1325761656-285x237.jpg;s:5:width;i:285;s:6:height;i:237;}s:14:post-top-story;a:3:{s:4:file;s:35:Picture3_410_1325761656-300x130.jpg;s:5:width;i:300;s:6:height;i:130;}}s:10:image_meta;a:10:{s:8:aperture;i:0;s:6:credit;s:0:;s:6:camera;s:0:;s:7:caption;s:0:;s:17:created_timestamp;i:0;s:9:copyright;s:0:;s:12:focal_length;i:0;s:3:iso;i:0;s:13:shutter_speed;i:0;s:5:title;s:0:;}} which is used in wordpress
I have a v. large text document (no file extension) that has information about
I have a textarea form which takes a large block of text. In this
I have a large Regular Expression I use for parsing my own file format
I have a large dataset (~1GB) stored in a custom file format, the last
I want to convert the text file into xml file .I have a large

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.