Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • Home
  • SEARCH
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 120085
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 11, 20262026-05-11T03:45:19+00:00 2026-05-11T03:45:19+00:00

I have a long string (a DNA sequence). It does not contain any whitespace

  • 0

I have a long string (a DNA sequence). It does not contain any whitespace character.

For example:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA 

What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox?

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. 2026-05-11T03:45:20+00:00Added an answer on May 11, 2026 at 3:45 am

    for block elements:

    <textarea style='width:100px; word-wrap:break-word;'>   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC </textarea>

    for inline elements:

    <span style='width:100px; word-wrap:break-word; display:inline-block;'>     ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC </span>

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Ask A Question

Stats

  • Questions 146k
  • Answers 146k
  • Best Answers 0
  • User 1
  • Popular
  • Answers
  • Editorial Team

    How to approach applying for a job at a company ...

    • 7 Answers
  • Editorial Team

    How to handle personal stress caused by utterly incompetent and ...

    • 5 Answers
  • Editorial Team

    What is a programmer’s life like?

    • 5 Answers
  • Editorial Team
    Editorial Team added an answer Nope. If you can't count on the number of columns… May 12, 2026 at 9:05 am
  • Editorial Team
    Editorial Team added an answer Yes, according to the schema definition found here. An if… May 12, 2026 at 9:05 am
  • Editorial Team
    Editorial Team added an answer If you use Process.Start you can pass in the Del… May 12, 2026 at 9:05 am

Related Questions

This is a C# problem. I have a big object in memory at a
I have a long string and I need to find instances of '#!#'+some text+'#!#'
I have a long string that I need to parse into an array of
I have a somewhat complex regular expression which I'm trying to match against a

Trending Tags

analytics british company computer developers django employee employer english facebook french google interview javascript language life php programmer programs salary

Top Members

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.