Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 668813
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 14, 20262026-05-14T00:04:56+00:00 2026-05-14T00:04:56+00:00

I have an interesting genetics problem that I would like to solve in native

  • 0

I have an interesting genetics problem that I would like to solve in native Python (nothing outside the standard library). This in order for the solution to be very easy to use on any computer, without requiring the user to install additional modules.

Here it is. I received 100,000s of DNA sequences (up to 2 billion) from a 454 new generation sequencing run. I want to trim the extremities in order to remove primers that may be present on both ends, both as normal and sense sequences. Example:

seq001: ACTGACGGATAGCTGACCTGATGATGGGTTGACCAGTGATC
        --primer-1---                 --primer-2-

Primers can be present one or multiple times (one right after the other). Normal sense are always on the left, and reverse on the right. My goal is thus to find the primers, cut the sequence such that only the primer-free part remains. For this, I want to use a classic alignment algorithm (ie: Smith-Waterman) that has been implemented in native Python (ie: not through biopython). I am aware of the fact that this may require quite some time (up to hours).

Note: This is NOT a direct “word” search, as DNA, both in the sequences and the primers, can be “mutated” for diverse technical reasons.

What would you use?

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-14T00:04:57+00:00Added an answer on May 14, 2026 at 12:04 am

    Researching that algorithm briefly, this is not easy stuff. This is going to take some very serious algorithm work. Try re-aligning your expectations from “hours” to “days or weeks”.

    The programmer implementing this will need:

    • High competence in general python programming
    • Algorithm programming experience, and a good understanding of time complexity.
    • A good understanding of python data structures such as dict, set, and deque, and their complexity characteristics.
    • Familiarity with unittests.

    That programmer may or may not be you right now. This sounds like an awesome project, good luck!

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have an interesting problem. I'd like to create a generic class that can
We have an interesting problem with WCF binding and streaming transfer mode that we
I have an interesting problem. I have a working M/R version of this but
I have this interesting situation. I have a bunch of structs that hold a
I have an interesting problem. Consider this class hierachy: class Base { public: virtual
I have an interesting problem and would appreciate your thoughts for the best solution.
I have an interesting problem that I'm struggling to fit in MapReduce. I have
I have an interesting situation that EMF forced me into: abstract class AbstractDog{ ...
I have this interesting obstacle on my project. I am currently doing a MVC3
I have some interesting problem for an hour.. In my flex project, all width

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.