Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 7734099
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: June 1, 20262026-06-01T07:09:55+00:00 2026-06-01T07:09:55+00:00

I have written the following code in Perl. I want to iterate through a

  • 0

I have written the following code in Perl. I want to iterate through a string 3 positions (characters) at a time. If TAA, TAG, or TGA (stop codons) appear, I want to print till the stop codons and remove the rest of the characters.


Example:

data.txt

ATGGGTAATCCCTAGAAATTT

ATGCCATTCAAGTAACCCTTT

Answer:

ATGGGTAATCCCTAG (last 6 characters removed)

ATGCCATTCAAGTAA (last 6 characters removed)

(Each sequence begins with ATG).


Code:

#!/usr/bin/perl -w

open FH, "data.txt";
@a=<FH>;

foreach $tmp(@a)
{
  for (my $i=0; $i<(length($tmp)-2); $i+=3)
  {
    if ($tmp=~/(ATG)(\w+)(TAA|TAG|TGA)\w+/)
    {
      print "$1$2$3\n";
    }
    else 
    { 
      print "$tmp\n"; 
    }
    $tmp++;
  }
}
exit;

However, my code is not giving the correct result. There should not be any overlaps in the characters (I want to move every 3 characters).

Can someone suggest how to fix the error?

Thanks!

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-06-01T07:09:56+00:00Added an answer on June 1, 2026 at 7:09 am

    Script:

    #!/usr/bin/perl
    
    use strict;
    use warnings;
    
    open FH, "data.txt";
    my @a = <FH>;
    
    foreach (@a) {
      print /^(ATG(...)*?(TAA|TAG|TGA))/? $1 : $_, "\n";
    }
    

    Output:

    ATGGGTAATCCCTAG
    ATGCCATTCAAGTAA
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have written the following code choice /m Do you want to add another
I have string which is of format: ;1=2011-10-23T16:16:53+0530;2=2011-10-23T16:16:53+0530;3=2011-10-23T16:16:53+0530;4=2011-10-23T16:16:53+0530; I have written following code to
I have written the following code.. installFunction(){ perl Makefile.PL flag1 = $? make flag2
Today, I have written a perl script, as the following code: my @files =
I have written following code which generates a browse and upload button.i want to
i have written the following code to copy a string hello world to another
I have written the following code in Perl. I have ActivePerl 5.14 for Windows
I want to have selected index for UITableView . I have written following code:
I have written following code to attach gesture recogniser to multiple imageviews. [imageview1 setUserInteractionEnabled:YES];
I am trying my hands on WPF MVVM. I have written following code in

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.