Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 7169005
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 28, 20262026-05-28T14:53:51+00:00 2026-05-28T14:53:51+00:00

I need an alternate sequence like 1, -1, 1, -1… asf. First I used

  • 0

I need an alternate sequence like 1, -1, 1, -1… asf. First I used if-statements for it, but it’s dumb. Then I tried something like:

int n = 1;
...
do{
   n = 0 + ( n * (-1));
} while(blabla)

It’s ok, but I have to store n value from iteration to iteration. This isn’t so pretty. How to compute that sequence from a control variable like frameCount?

Sorry, I am learning not only to code, but English too.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-28T14:53:53+00:00Added an answer on May 28, 2026 at 2:53 pm

    It’s not very readable, but if you’re looking for something purely “elegant,” I suppose you could do something like:

    int n = 1 - ((frameCount % 2) * 2);
    

    If you’re on an even frame you’ll be subtracting (1 – 0), if you’re on odd frame you’ll be subtracting (1 – 2).

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I need to alternate row colors in a grid, but not on every other
I need to alternate a date and a phrase within a <table> cell without
I need to create a table that has both alternate and rounded TR corners,
I need a cPanel alternative, but with easy deployable Ruby-Rack applications support, not only
Need to apply a filter to a file like this: TUPAC_0006:1:1:2554:2356#0/1 0 * 0
I need to create alternate row colours in my RDLC report which also takes
I need a button that is visually completely customizable, but has custom logic to
So I got a DNA sequence. ACCAGAGCGGCACAGCAGCGACATCAGCACTAGCACTAGCATCAGCATCAGCATCAGC CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT ACACCCCCCCCGGTGTGTGTGGGGGGTTAAAAATGATGAGTGATGAGTGAGTTGTGTG CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT TTCTATCATCATTCGGCGGGGGGATATATTATAGCGCGCGATTATTGCGCAGTCTACG TCATCGACTACGATCAGCATCAGCATCAGCATCAGCATCGACTAGCATCAGCTACGAC I need
I have a need to assign the next sequence number for a Project according
I need to get an array containing reversed alternate elements of the original array.

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.