Question

I want a regular expression that would check if a string contains any character apart from “A” , “G”, “C” , “U”
e
the string would be like ggggugcccgcuagagagacagu

i want regex to check if it containns only these , it is not case sensitive.

what i tried

match= re.match(r'[^GaAgUuCc]',seq2)

It is to find non RNA characters in a RNA sequence

Answer 1

You should use re.search() or re.findall() rather than re.match():

In [9]: seq2 = 'ggggugcccQgcuagagaZgacagu'

In [10]: re.findall(r'[^GaAgUuCc]',seq2)
Out[10]: ['Q', 'Z']