I want a regular expression that would check if a string contains any character apart from “A” , “G”, “C” , “U”
e
the string would be like ggggugcccgcuagagagacagu
i want regex to check if it containns only these , it is not case sensitive.
what i tried
match= re.match(r'[^GaAgUuCc]',seq2)
It is to find non RNA characters in a RNA sequence
You should use
re.search()orre.findall()rather thanre.match():