Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 1067959
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 16, 20262026-05-16T20:13:27+00:00 2026-05-16T20:13:27+00:00

I was assigned a problem to find genes when given a string of the

  • 0

I was assigned a problem to find genes when given a string of the letters A,C,G, or T all in a row, like ATGCTCTCTTGATTTTTTTATGTGTAGCCATGCACACACACACATAAGA. A gene is started with ATG, and ends with either TAA, TAG, or TGA (the gene excludes both endpoints). The gene consists of triplets of letters, so its length is a multiple of three, and none of those triplets can be the start/end triplets listed above. So, for the string above the genes in it are CTCTCT and CACACACACACA. And in fact my regex works for that particular string. Here’s what I have so far (and I’m pretty happy with myself that I got this far):

(?<=ATG)(([ACGT]{3}(?<!ATG))+?)(?=TAG|TAA|TGA)

However, if there is an ATG and end-triplet within another result, and not aligned with the triplets of that result, it fails. For example:

Results for TCGAATGTTGCTTATTGTTTTGAATGGGGTAGGATGACCTGCTAATTGGGGGGGGGG :
TTGCTTATTGTTTTGAATGGGGTAGGA
ACCTGC

It should find also a GGG but doesn’t: TTGCTTATTGTTTTGA(ATG|GGG|TAG)GA

I’m new to regex in general and a little stuck…just a little hint would be awesome!

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-16T20:13:27+00:00Added an answer on May 16, 2026 at 8:13 pm

    Here’s a possible regex:

    (?=(ATG((?!ATG)[ATGC]{3})*(TAA|TAG|TGA)))
    

    A little test-rig:

    public class Main {
        public static void main(String[]args) {
            String source = "TCGAATGTTGCTTATTGTTTTGAATGGGGTAGGATGACCTGCTAATTGGGGGGGGGGATGATGTAG";
            Matcher m = Pattern.compile("(?=(ATG((?!ATG)[ATGC]{3})*(TAA|TAG|TGA)))").matcher(source);
            System.out.println("source : "+source+"\nmatches:");
            while(m.find()) {
                System.out.print("         ");
                for(int i = 0; i < m.start(); i++) {
                    System.out.print(" ");
                }
                System.out.println(m.group(1));
            }
        }
    }
    

    which produces:

    source : TCGAATGTTGCTTATTGTTTTGAATGGGGTAGGATGACCTGCTAATTGGGGGGGGGGATGATGTAG
    matches:
                 ATGTTGCTTATTGTTTTGAATGGGGTAGGATGACCTGCTAATTGGGGGGGGGGATGA
                                    ATGGGGTAG
                                              ATGACCTGCTAA
                                                                         ATGTAG
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I recently started to think of this problem and I can't find the answer.
I'm trying to find all WorkItems that were assigned to a person X in
Okay guys, basically the problem I'm having is this. I've been assigned to write
I wanted some input on an interesting problem I've been assigned. The task is
I have some problem about operator overloading. I looked everywhere but couldn't find a
I have this Problem and solving it is not the problem, more like what
I'm writing a custom StyleCop rule to prevent String variables being assigned null ,
I would like to know what is the problem name for TSP w/o considering
I'm totally new to opencv, and I was recently assigned an assignment to find
I have an interesting problem. I'd like to create a generic class that can

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.