Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 8837795
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: June 14, 20262026-06-14T09:49:09+00:00 2026-06-14T09:49:09+00:00

I’m looking to create a regular expression in python that matches all DNA sequences

  • 0

I’m looking to create a regular expression in python that matches all DNA sequences starting with T followed by 18 characters (any characters) and then terminated by either AA, TT, CC or GG. I can manage the first part but I can’t seem to find a way to write the end (the double characters) without duplicating the regex 4 times.
Here’s what I have for a sequence ending in TT:

import re
seq='ATGTGTGGACACAAGTGACAGTTTACGATGAGGTTACAGCCCGCA'
match=re.findall('T.{18}TT',seq)
print match
  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-06-14T09:49:10+00:00Added an answer on June 14, 2026 at 9:49 am

    Check out a good tutorial.

    There is a concept called alternation. It matches any one of the given options:

    r'T.{18}(?:TT|AA|CC|GG)'
    

    Note that you should use raw strings to encode regexes in Python, otherwise you will get problems with escaping characters later.

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

link Im having trouble converting the html entites into html characters, (&# 8217;) i
I have a string like this: La Torre Eiffel paragonata all’Everest What PHP function
I'm parsing an RSS feed that has an ’ in it. SimpleXML turns this
I have a text area in my form which accepts all possible characters from
I need a function that will clean a strings' special characters. I do NOT
I'm trying to create an if statement in PHP that prevents a single post
Let's say I'm outputting a post title and in our database, it's Hello Y’all
I have a jquery bug and I've been looking for hours now, I can't
That's pretty much it. I'm using Nokogiri to scrape a web page what has
I want to count how many characters a certain string has in PHP, but

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.