Question

I’m trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string “ATG”, but I don’t want to actually stop the first match at the “ATG”. Valid input is any ordering of a string of As, Cs, Gs, and Ts.

For example, given the input string: ATGAACATAGGACATGAGGAGTCA
I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of “ATG” onward). A string that contains “ATG” n times should result in n results.

I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn’t. If this can’t be done with a regexp it’s easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

Answer 1

If you really want to use regular expressions, try this:

var str = "ATGAACATAGGACATGAGGAGTCA",
    re = /ATG.*/g, match, matches=[];
while ((match = re.exec(str)) !== null) {
    matches.push(match);
    re.lastIndex = match.index + 3;
}

But be careful with exec and changing the index. You can easily make it an infinite loop.

Otherwise you could use indexOf to find the indices and substr to get the substrings:

var str = "ATGAACATAGGACATGAGGAGTCA",
    offset=0, match=str, matches=[];
while ((offset = match.indexOf("ATG", offset)) > -1) {
    match = match.substr(offset);
    matches.push(match);
    offset += 3;
}