Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 865889
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 15, 20262026-05-15T09:42:39+00:00 2026-05-15T09:42:39+00:00

I’m trying to split up a nucleotide sequence into amino acid strings using a

  • 0

I’m trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string “ATG”, but I don’t want to actually stop the first match at the “ATG”. Valid input is any ordering of a string of As, Cs, Gs, and Ts.

For example, given the input string: ATGAACATAGGACATGAGGAGTCA
I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of “ATG” onward). A string that contains “ATG” n times should result in n results.

I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn’t. If this can’t be done with a regexp it’s easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-15T09:42:40+00:00Added an answer on May 15, 2026 at 9:42 am

    If you really want to use regular expressions, try this:

    var str = "ATGAACATAGGACATGAGGAGTCA",
        re = /ATG.*/g, match, matches=[];
    while ((match = re.exec(str)) !== null) {
        matches.push(match);
        re.lastIndex = match.index + 3;
    }
    

    But be careful with exec and changing the index. You can easily make it an infinite loop.

    Otherwise you could use indexOf to find the indices and substr to get the substrings:

    var str = "ATGAACATAGGACATGAGGAGTCA",
        offset=0, match=str, matches=[];
    while ((offset = match.indexOf("ATG", offset)) > -1) {
        match = match.substr(offset);
        matches.push(match);
        offset += 3;
    }
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I'm new to using the Perl treebuilder module for HTML parsing and can't figure
link Im having trouble converting the html entites into html characters, (&# 8217;) i
I have a string like this: La Torre Eiffel paragonata all’Everest What PHP function
this is what i have right now Drawing an RSS feed into the php,
I have a French site that I want to parse, but am running into
I have thousands of HTML files to process using Groovy/Java and I need to
I am trying to loop through a bunch of documents I have to put
I have a .ini file as follows: [playlist] numberofentries=2 File1=http://87.230.82.17:80 Title1=(#1 - 365/1400) Example
I am trying to understand how to use SyndicationItem to display feed which is
Basically, what I'm trying to create is a page of div tags, each has

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.