Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 8560869
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: June 11, 20262026-06-11T16:22:32+00:00 2026-06-11T16:22:32+00:00

I’m trying to write a script that can use a reading frame of 3

  • 0

I’m trying to write a script that can use a reading frame of 3 to detect a certain pattern and then from that sequence, go in multiples of 3 to find another pattern

sequence = 'TCATGAGGCTTTGGTAAATAT'

i need it to:

…scan with a reading frame of 3 until it finds a desired pattern (i.e. ‘ATG’)

…mark the location of where the first pattern (‘ATG’) started in the original sequence and the position of where the second pattern started (‘TAA’). In this case, it would be position 3 for ‘ATG’ and 15 for ‘TAA’ .

…create a list with each triplet that follows the first pattern until it reaches the second pattern ‘TAA’ (i.e. ‘ATG’,’AGG’,’CTT’,TGG’,’TAA’)

How do I construct a reading frame to read it in sets of 3 ? I know that once i find a way to get the reading i can create an if statement saying

reading_frame=[]

for frame in sequence:
    if k == 'ATG':
        reading_frame.append(k)

first i need the reading frame

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-06-11T16:22:33+00:00Added an answer on June 11, 2026 at 4:22 pm
    sequence = 'TCATGAGGCTTTGGTAAATAT'
    
    frame1 = sequence.find('ATG')
    
    my_list = []
    
    for codon in range(len(sequence)):
        next_codon = sequence[frame1:frame1+3]
        my_list.append(next_codon)
        frame1 +=3
        if next_codon == 'TAA':
            break
    
    print my_list
    

    [‘ATG’, ‘AGG’, ‘CTT’, ‘TGG’, ‘TAA’]

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I am trying to understand how to use SyndicationItem to display feed which is
I'm parsing an RSS feed that has an ’ in it. SimpleXML turns this
I'm trying to decode HTML entries from here NYTimes.com and I cannot figure out
Does anyone know how can I replace this 2 symbol below from the string
I'm trying to use string.replace('’','') to replace the dreaded weird single-quote character: ’ (aka
I'm trying to create an if statement in PHP that prevents a single post
Basically, what I'm trying to create is a page of div tags, each has
I'm new to using the Perl treebuilder module for HTML parsing and can't figure
link Im having trouble converting the html entites into html characters, (&# 8217;) i
That's pretty much it. I'm using Nokogiri to scrape a web page what has

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.