Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 6862311
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 27, 20262026-05-27T02:38:48+00:00 2026-05-27T02:38:48+00:00

Is there a method in Perl (not BioPerl ) to find the number of

  • 0

Is there a method in Perl (not BioPerl) to find the number of each two consecutive letters.

I.e., number of AA, AC, AG, AT, CC, CA, ... in a sequence like this:

$sequence = 'AACGTACTGACGTACTGGTTGGTACGA'

PS: We can make it manually by using the regular expression, i.e., $GC=($sequence=~s/GC/GC/g) which return the number of GC in the sequence.

I need an automated and generic way.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-27T02:38:48+00:00Added an answer on May 27, 2026 at 2:38 am

    You had me confused for a while, but I take it you want to count the dinucleotides in a given string.

    Code:

    my @dinucs = qw(AA AC AG CC CA CG);
    my %count;
    my $sequence = 'AACGTACTGACGTACTGGTTGGTACGA';
    
    for my $dinuc (@dinucs) {
        $count{$dinuc} = ($sequence =~ s/\Q$dinuc\E/$dinuc/g);
    }
    

    Output from Data::Dumper:

    $VAR1 = {
              "AC" => 5,
              "CC" => "",
              "AG" => "",
              "AA" => 1,
              "CG" => 3,
              "CA" => ""
            };
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

Is there builtin method that would do this or do I always have to
Is there a method that could tell for a string like foo bar Foo
I'm creating a new object like this: TestObject->new(@array1, @array2) My new method looks like
There are already questions about the Perl+AJAX, like here , here or here and
is there a method to verify if a NSString haven't characters? example of string
Is there a method to return the position of the character in the JTextField.
is there a method to link specific files so that I can reference them
Is there any method I can get the full JSON data from jqGrid when
Is there a method which allows to know parent item of leaf tapped item?
Is there a method to launch an Internet Explorer window from a desktop Icon

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.