Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 8759295
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: June 13, 20262026-06-13T14:46:00+00:00 2026-06-13T14:46:00+00:00

Ok so I need to extract part of a sequence from a FASTA file,

  • 0

Ok so I need to extract part of a sequence from a FASTA file, using python (biopython, http://biopython.org/DIST/docs/tutorial/Tutorial.html)

I need to get the first 10 bases from each sequence and put them in one file, preserving the sequence info from the FASTA format. Worst comes to worst, I could just use the bases if there’s no way to keep the sequence info. So here’s an example:

>gi|2765658|emb|Z78533.1|CIZ78533 C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA
CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG
AATCCGGAGGACCGGTGTACTCAGCTCACCGGGGGCATTGCTCCCGTGGTGACCCTGATTTGTTGTTGGG

>gi|2765658|emb|Z78533.1|CIZ78533 C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA
CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG
AATCCGGAGGACCGGTGTACTCAGCTCACCGGGGGCATTGCTCCCGTGGTGACCCTGATTTGTTGTTGGG

>gi|2765658|emb|Z78533.1|CIZ78533 C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA
CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG
AATCCGGAGGACCGGTGTACTCAGCTCACCGGGGGCATTGCTCCCGTGGTGACCCTGATTTGTTGTTGGG

I need some way to get the first 10 bases (and then I was planning on doing it again for the last 10 bases). That tutorial site is pretty thorough but I’m new to this and since it doesn’t go into this, I’m not even sure if it’s possible. Thanks for any help you can give.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-06-13T14:46:02+00:00Added an answer on June 13, 2026 at 2:46 pm

    Biopython is just perfect for these kinds of tasks. The Seq-Object stores a sequence and info about it. Reading the fasta file format is straight forward. You can access the sequence like a simple list and, hence, access certain positions straight forward as well:

    from Bio import SeqIO
    
    with open("outfile.txt","w") as f:
            for seq_record in SeqIO.parse("infile.fasta", "fasta"):
                    f.write(str(seq_record.id) + "\n")
                    f.write(str(seq_record.seq[:10]) + "\n")  #first 10 base positions
                    f.write(str(seq_record.seq[-10:]) + "\n") #last 10 base positions
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I need to extract attribute values from <Item Name=CanonicalSmiles> from following XML file (part
I have HTML that I need to extract a part number from, the HTML
Need to extract .co.uk urls from a file with lots of entries, some .com
I need to extract the first part of postcode for search calculation using a
Using Crystal Reports 2008, I need to extract a date from a text field.
I need to extract some data from a webpage with php. The part that
I need to extract data from lines of a text file. The data is
I need to extract requests from a log file that look like this :
I have a 1.3GB text file that I need to extract some information from
I need to extract Gleason scores from a flat file of prostatectomy final diagnostic

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.