Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • Home
  • SEARCH
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 7687195
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 31, 20262026-05-31T19:38:59+00:00 2026-05-31T19:38:59+00:00

Recently, I started writing a program to compare DNA sequence. As the alphabet only

  • 0

Recently, I started writing a program to compare DNA sequence. As the alphabet only consists of four letters (ATCG), compressing each character to 2 bits seemed like it would offer faster comparisons (are two characters the same or different). However, when I ran a test char comparisons were much faster than bit comparisons (by ~30%). Compression was carried out in both programs as a control. What am I missing here? Is there a more efficient way to compare bits?
p.s. I also tried vector, but it was a bit slower than bitset.

// File: bittest.cc
// Test use of bitset container

#include <ctime>
#include <iostream>
#include <bitset>
#include <vector>
#include <string>
using namespace std;

void compress(string&, bitset<74>&);
void compare(bitset<74>&, bitset<74>&);

int main()
{
   // Start timer
   std::clock_t start;
   double difference;
   start = std::clock();

   for(int i=0; i<10000000; ++i){
      string frag1="ATCGACTGACTGACTGACTGACTGACTGACTGACTGA";
      string frag2="AACGAACGAACGAACGAACGAACGAACGAACGAACGA";
      int a=37;
      bitset<74> bits1;
      bitset<74> bits2;
      compress(frag1, bits1);
      compress(frag2, bits2);
      compare(bits1, bits2);
   }

   difference = ( std::clock() - start ) / (double)CLOCKS_PER_SEC;
   int minutes = difference/60;
   int seconds = difference - minutes * 60;

   if (seconds < 10){
      cout << "\nRunning time: " << minutes << ":0" << seconds << endl << endl;
   }else{
      cout << "\nRunning time: " << minutes << ":" << seconds << endl << endl;
   }

   return 0;
}

void compress(string& in, bitset<74>& out){
   char c;
   int b=0;
   for(int i=0; i<in.length(); ++i){
      c=in[i];
      b=2*i;
      switch(c){
        case 'A':
           break;
        case 'C':
           out.set(b+1);
           break;
        case 'G':
           out.set(b);
           break;
        case 'T':
           out.set(b);
           out.set(b+1);
           break;
        default:
           cout << "Invalid character in fragment.\n";
      }
   }
}

void compare(bitset<74>& a, bitset<74>& b){
   for(int i=0; i<74; ++i){
      if(a[i] != b[i]){
      }
   }
}

And the string harness…

// File: bittest.cc

#include <ctime>
#include <iostream>
#include <bitset>
#include <vector>
#include <string>
using namespace std;

void compress(string&, bitset<74>&);
void compare(string&, string&);

int main()
{
   // Start timer
   std::clock_t start;
   double difference;
   start = std::clock();

   for(int i=0; i<10000000; ++i){
      string frag1="ATCGACTGACTGACTGACTGACTGACTGACTGACTGA";
      string frag2="AACGAACGAACGAACGAACGAACGAACGAACGAACGA";
      int a=37;
      bitset<74> bits1;
      bitset<74> bits2;
      compress(frag1, bits1);
      compress(frag2, bits2);
      compare(frag1, frag2);
   }

   difference = ( std::clock() - start ) / (double)CLOCKS_PER_SEC;
   int minutes = difference/60;
   int seconds = difference - minutes * 60;

   if (seconds < 10){
      cout << "\nRunning time: " << minutes << ":0" << seconds << endl << endl;
   }else{
      cout << "\nRunning time: " << minutes << ":" << seconds << endl << endl;
   }

   return 0;
}

void compress(string& in, bitset<74>& out){
   char c;
   int b=0;
   for(int i=0; i<in.length(); ++i){
      c=in[i];
      b=2*i;
      switch(c){
        case 'A':
           break;
        case 'C':
           out.set(b+1);
           break;
        case 'G':
           out.set(b);
           break;
        case 'T':
           out.set(b);
           out.set(b+1);
           break;
        default:
           cout << "Invalid character in frag.\n";
      }
   }
}

void compare(string& a, string& b){
   for(int i=0; i<37; ++i){
      if(a[i] != b[i]){
      }
   }
}
  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-31T19:39:00+00:00Added an answer on May 31, 2026 at 7:39 pm

    Consider the two comparison routines:

    void compare(bitset<74>& a, bitset<74>& b){
       for(int i=0; i<74; ++i){
          if(a[i] != b[i]){
          }
       }
    }
    

    and

    void compare(string& a, string& b){
       for(int i=0; i<37; ++i){
          if(a[i] != b[i]){
          }
       }
    }
    

    Right off the bat you can see that one is executing the loop 74 times and the other is executing the loop 37 times. So already the bitset approach is starting from a position of weakness.

    Now consider the types of data being accessed; accessing individual bytes is reasonably quick; accessing individual bits from any data structure might store a single bit in an entire byte or maybe even some larger word size. If it stores bits in individual bits, then some bitmasking operations must be introduced, and those all take processing power too. If the bits are stored in bytes, then you are in fact comparing only half of each character on each bit. If the bits are stored in words or larger, you are increasing the size of the CPU’s data cache — potentially taking something that might fit entirely in one cache line to several cache lines. That’s a potential for gigantic speed penalties, though on inputs this small, it’s probably not too horrible yet.

    If you replace your bitset with a char[] that is large enough to hold all your data, manually set the bits yourself in the compression routines, and then compare the char[] array a byte at a time or larger, you can probably drastically improve the speed of the comparison routines. Will the speed up be sufficient to overcome the cost of the compression routines? That’s tough to say and depends in part upon how many comparisons you can make with each compressed form.

    If you can perform your comparison using int or larger datatypes, you can probably go even significantly faster, as modern CPUs are usually faster at accessing 4-bytes or 8-bytes at a time than 1-byte at a time. Most strcmp(3) or memcmp(3) routines are optimized to perform huge, aligned reads. If you use memcmp(3) to do your comparison, you’ll have the best chance of going at top speed — and that goes for both the compressed and uncompressed versions.

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I've recently started coding in C++, but I have long time writing in C.
Recently I started writing some doxygen docs in an existing project which already has
I've been writing programs using OpenGL. Recently, I started learning OpenGL Shading Language. I'm
I recently started playing around with writing Perl (v5.8.8) extensions using XS. One of
This is my first post, and I've only recently started programming for Android and
I downloaded Flash Builder from here : Download I recently started writing some small
I'm writing an iPhone application using Monotouch and recently the app has started crashing
I recently started writing a C++/CLI wrapper for a native c++ library. I'm now
I recently started writing code that uses newer implementations of OpenGL. I did however
I recently started using emacs for writing my programs codes. I was wondering if

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.