Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • Home
  • SEARCH
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 1004971
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 16, 20262026-05-16T08:13:02+00:00 2026-05-16T08:13:02+00:00

Why am i getting an invalid syntax when i run below code. Python 2.7

  • 0

Why am i getting an “invalid syntax” when i run below code. Python 2.7

from string import *

def countSubStringMatch(target,key):
    counter=0
    fsi=0 #fsi=find string index
    while fsi<len(target):
        fsi=dna.find(key,fsi)      
        if fsi!=-1:
           counter+=1
        else:
            counter=0
            fsi=fsi+1
        fsi=fsi+1
    #print '%s is %d times in the target string' %(key,counter)

def countSubStringMatch("atgacatgcacaagtatgcat","atgc")
  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-16T08:13:03+00:00Added an answer on May 16, 2026 at 8:13 am

    In the line:

    def countSubStringMatch("atgacatgcacaagtatgcat","atgc")
    

    You should remove the def. def is used when defining a function, not when calling it.

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I'm trying to execute the following code, but I'm getting SyntaxError: invalid syntax at
My code is getting the following error: free(): invalid next size (fast) My code:
I'm trying to run this snippet in Python 3.1 console and I'm getting SyntaxError:
I am getting this error: DataError: (DataError) invalid input syntax for integer: 1.50 CONTEXT:
Why is this complaining about an invalid syntax? #! /usr/bin/python recipients = [] recipients.append('me@example.com')
I'm loading some python code from a database (it's doing dynamic mapping of values
I'm getting invalid syntax errors pointing to the in statement. What's my mistake? while(notes
i am trying to install simplejson2.4 on RedHat however getting: SyntaxError: Invalid syntax encoder.py
I am getting invalid syntax on the following: rootdir = 'c://temp/test//files//' for subdir, dirs,
I am getting a syntax error in a python file and I'm really new

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.