Home/ Questions/Q 690857
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Asked: 2026-05-14T02:28:47+00:00

I am using LaTeX and I have a problem concerning string manipulation. I want

  • 0

I am using LaTeX and I have a problem concerning string manipulation.
I want to have an operation applied to every character of a string, specifically
I want to replace every character “x” with “\discretionary{}{}{}x”. I want to do
this because I have a long string (DNA) which I want to be able to separate at
any point without hyphenation.

Thus I would like to have a command called “myDNA” that will do this for me instead of
inserting manually \discretionary{}{}{} after every character.

Is this possible? I have looked around the web and there wasnt much helpful
information on this topic (at least not any I could understand) and I hoped
that you could help.

–edit
To clarify:
What I want to see in the finished document is something like this:


    the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA
    AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG
    ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT
    ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT
    CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC
    CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT
    AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT

just plain linebreaks, without any hyphens. The DNA sequence will be one
long string without any spaces or anything but it can break at any point.
This is why my idea was to inesert a “\discretionary{}{}{}” after every
character, so that it can break at any point without inserting any hyphens.

Share

Leave an answer

You must login to add an answer.

Need An Account,

1 Answer

  1. Editorial Team

    This takes a string as an argument and calls \discretionary{}{}{} after each character. The input string stops at the first dollar sign, so you should not use that.

    \def\hyphenateWholeString #1{\xHyphenate#1$\wholeString}

\def\xHyphenate#1#2\wholeString {\if#1$%
\else\say{#1}\discretionary{}{}{}%
\takeTheRest#2\ofTheString
\fi}

\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}

\def\say#1{#1}

    You’d call it like \hyphenateWholeString{CTAAAGAAAACAGGACG}.

    Instead of \discretionary{}{}{} you can also try \hspace{0pt}, if you like that more (and are in a latex environment). In order to align the right margin, I think you’d need to do some more fine tuning (but see below). The effect is of course minimised by using a font of fixed width.

    Revision:

    \def\hyphenateWholeString #1{\xHyphenate#1$\wholeString\unskip}

\def\xHyphenate#1#2\wholeString {\if#1$%
\else\transform{#1}%
\takeTheRest#2\ofTheString\fi}

\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}

\def\transform#1{#1\hskip 0pt plus 1pt}

    Steve’s suggestion of using \hskip sounds like a very good idea to me, so I made a few corrections. Note that I’ve renamed the \say macro and made it more useful in that it now actually does the transformation. (However, if you remove the \hskip from \transform, you’ll also need to remove the \unskip in the main macro definition.

    Edit:

    There is also the seqsplit package which seems to be made for printing DNA data or long numbers. They also bring a few options for nicer output, so maybe that is what you’re looking for…

    • 0