Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 690857
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 14, 20262026-05-14T02:28:47+00:00 2026-05-14T02:28:47+00:00

I am using LaTeX and I have a problem concerning string manipulation. I want

  • 0

I am using LaTeX and I have a problem concerning string manipulation.
I want to have an operation applied to every character of a string, specifically
I want to replace every character “x” with “\discretionary{}{}{}x”. I want to do
this because I have a long string (DNA) which I want to be able to separate at
any point without hyphenation.

Thus I would like to have a command called “myDNA” that will do this for me instead of
inserting manually \discretionary{}{}{} after every character.

Is this possible? I have looked around the web and there wasnt much helpful
information on this topic (at least not any I could understand) and I hoped
that you could help.

–edit
To clarify:
What I want to see in the finished document is something like this:


    the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA
    AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG
    ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT
    ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT
    CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC
    CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT
    AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT

just plain linebreaks, without any hyphens. The DNA sequence will be one
long string without any spaces or anything but it can break at any point.
This is why my idea was to inesert a “\discretionary{}{}{}” after every
character, so that it can break at any point without inserting any hyphens.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-14T02:28:47+00:00Added an answer on May 14, 2026 at 2:28 am

    This takes a string as an argument and calls \discretionary{}{}{} after each character. The input string stops at the first dollar sign, so you should not use that.

    \def\hyphenateWholeString #1{\xHyphenate#1$\wholeString}
    
    \def\xHyphenate#1#2\wholeString {\if#1$%
    \else\say{#1}\discretionary{}{}{}%
    \takeTheRest#2\ofTheString
    \fi}
    
    \def\takeTheRest#1\ofTheString\fi
    {\fi \xHyphenate#1\wholeString}
    
    \def\say#1{#1}
    

    You’d call it like \hyphenateWholeString{CTAAAGAAAACAGGACG}.

    Instead of \discretionary{}{}{} you can also try \hspace{0pt}, if you like that more (and are in a latex environment). In order to align the right margin, I think you’d need to do some more fine tuning (but see below). The effect is of course minimised by using a font of fixed width.

    Revision:

    \def\hyphenateWholeString #1{\xHyphenate#1$\wholeString\unskip}
    
    \def\xHyphenate#1#2\wholeString {\if#1$%
    \else\transform{#1}%
    \takeTheRest#2\ofTheString\fi}
    
    \def\takeTheRest#1\ofTheString\fi
    {\fi \xHyphenate#1\wholeString}
    
    \def\transform#1{#1\hskip 0pt plus 1pt}
    

    Steve’s suggestion of using \hskip sounds like a very good idea to me, so I made a few corrections. Note that I’ve renamed the \say macro and made it more useful in that it now actually does the transformation. (However, if you remove the \hskip from \transform, you’ll also need to remove the \unskip in the main macro definition.


    Edit:

    There is also the seqsplit package which seems to be made for printing DNA data or long numbers. They also bring a few options for nicer output, so maybe that is what you’re looking for…

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

Scenario: I have a document I created using LaTeX (my resume in this case),
I have installed the vim-latex package using Ubuntu Synaptic package manager and updated my
I am using the Vim-Latex now. But I have a question, when everytime I
Currently i have started using Nick Jhonshon's bloggart on appengine, later i do want
I'm using LaTeX and BibTeX for an article, and I want to able to
First of all, let me say I'm using LyX, though I have no problem
Here's my problem. I have a bunch of figures already written in a LaTeX
I am writing my MSc with LaTeX and I have the problem that sometimes
I have many instances of the same type of problem using jQuery. Probably because
I have a problem using fire() with a GWT RequestFactory after I've used it

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.