I am very new to Linux operating system and unable to install softwares necessary for my work.
when i use the command
setenv QUERY_STRING
"pass=lucy& sequence=UGCCUGGCGGCCUUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU&mask=((((((((((.........((((....)))).((((((((((.....(((....)))...(((((.......))))).))))))))))..(((.(((....))))))..)))))))))).&convert=true&explore=7&name=5S_rRNA"
./mcfold.static.exe > 5S_rRNA.data
Its showing the command setnev doesnot exist. How to set environment variable? I am using ubuntu 10.4
Please help!
setenvworks only in the CShell. If you are using BASH then use the commandexport