Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 7057425
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 28, 20262026-05-28T03:59:04+00:00 2026-05-28T03:59:04+00:00

I am very new to Linux operating system and unable to install softwares necessary

  • 0

I am very new to Linux operating system and unable to install softwares necessary for my work.

when i use the command

setenv QUERY_STRING 
"pass=lucy& sequence=UGCCUGGCGGCCUUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU&mask=((((((((((.........((((....)))).((((((((((.....(((....)))...(((((.......))))).))))))))))..(((.(((....))))))..)))))))))).&convert=true&explore=7&name=5S_rRNA"
./mcfold.static.exe > 5S_rRNA.data 

Its showing the command setnev doesnot exist. How to set environment variable? I am using ubuntu 10.4

Please help!

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-28T03:59:05+00:00Added an answer on May 28, 2026 at 3:59 am

    setenv works only in the CShell. If you are using BASH then use the command export

    export QUERY_STRING="pass=lucy&sequence=UGCCUGGCGGCCUUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU&mask=((((((((((.........((((....)))).((((((((((.....(((....)))...(((((.......))))).))))))))))..(((.(((....))))))..)))))))))).&convert=true&explore=7&name=5S_rRNA"
    
    ./mcfold.static.exe > 5S_rRNA.data 
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I'm very new to Linux and programming on Linux. I'm trying to install OpenAL
I am very new to linux and perl and I am trying to use
does anybody know what this vi command means? am very new with Linux and
Okay, I'm very new to linux and command line, and fairly new to java.
I am very new to the linux/unix command line and I am having some
I am very new to the linux OS so I am trying to design
I'm very new to Linux/C. In the glibc(eglibs-2.15) sources on my Linux I can
I'm new to both of these tools, and I'm also very new to Linux
I'm very new to Linux and PHP so forgive me if this is a
I am very new to MySQL. Linux. I want to create a database in

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.