Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 6122503
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 23, 20262026-05-23T15:54:23+00:00 2026-05-23T15:54:23+00:00

I have a genomic database, which contains a simple character sequence (like >chr1 AGTGTCA…..

  • 0

I have a genomic database, which contains a simple character sequence (like >chr1 AGTGTCA.....). Now, I want to convert it to the standard FASTQ format like this:

@HWUSI-EAS594-R:1:3:1453:1350#0/1 
CCCAGTTCCGACGATCGATTTGCACGTCAGAATCGCTACGGACCTCCATCAGGGTTTCCCCTGACTTCGTCCTGACCAGG
+   
ea^cdfdffgggggggggggeggggdggdffgdbdgddgggg`g^dfbfgdggcfbgfffcb]gffbfcfcefbbBBBB

As I have no clear idea about this type of format, I am not able to convert it. How can I convert a simple character sequence to the FASTQ format (as in the above example)?

Specifically, I am asking:

  1. Is there any existing code to do the encoding?
  2. If not, how can I encode the character sequence in FASTQ? What does this format imply and how can I create it?
  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-23T15:54:24+00:00Added an answer on May 23, 2026 at 3:54 pm

    Because you only have the sequence and not the quality (reliability) scores of the sequence derivation, I think you don’t have enough information to construct a FASTQ file. (I am not a bioinformatics expert, however.) Instead, you should probably keep using the FASTA file format, which contains only the sequence information.

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have an Oracle 10g database of genomic data with several >100 million row
Have a procedure which looks like Procedure TestProc(TVar1, TVar2 : variant); Begin TVar1 :=
Have a simple form that has a PictureBox in one location. I want to
I have file which looks like this: >gi|358482566|ref|NW_003766328.1| Gallus gallus breed Red Jungle fowl,
have a php code like this,going to convert it in to C#. function isValid($n){
Have a simple one-off tasks which needs a progress bar. OpenSSL has a useful
Have found maven to use hard for simple things like jar-signing ..May be I
Have a text box which get data for price. If someone enter something like
Have you ever tried working with a XAML file which contains thousand tons of
have written this little class, which generates a UUID every time an object of

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.