I have to write a script to translate this sequence:
dict = {"TTT":"F|Phe","TTC":"F|Phe","TTA":"L|Leu","TTG":"L|Leu","TCT":"S|Ser","TCC":"S|Ser",
"TCA":"S|Ser","TCG":"S|Ser", "TAT":"Y|Tyr","TAC":"Y|Tyr","TAA":"*|Stp","TAG":"*|Stp",
"TGT":"C|Cys","TGC":"C|Cys","TGA":"*|Stp","TGG":"W|Trp", "CTT":"L|Leu","CTC":"L|Leu",
"CTA":"L|Leu","CTG":"L|Leu","CCT":"P|Pro","CCC":"P|Pro","CCA":"P|Pro","CCG":"P|Pro",
"CAT":"H|His","CAC":"H|His","CAA":"Q|Gln","CAG":"Q|Gln","CGT":"R|Arg","CGC":"R|Arg",
"CGA":"R|Arg","CGG":"R|Arg", "ATT":"I|Ile","ATC":"I|Ile","ATA":"I|Ile","ATG":"M|Met",
"ACT":"T|Thr","ACC":"T|Thr","ACA":"T|Thr","ACG":"T|Thr", "AAT":"N|Asn","AAC":"N|Asn",
"AAA":"K|Lys","AAG":"K|Lys","AGT":"S|Ser","AGC":"S|Ser","AGA":"R|Arg","AGG":"R|Arg",
"GTT":"V|Val","GTC":"V|Val","GTA":"V|Val","GTG":"V|Val","GCT":"A|Ala","GCC":"A|Ala",
"GCA":"A|Ala","GCG":"A|Ala", "GAT":"D|Asp","GAC":"D|Asp","GAA":"E|Glu",
"GAG":"E|Glu","GGT":"G|Gly","GGC":"G|Gly","GGA":"G|Gly","GGG":"G|Gly"}
seq = "TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA"
a=""
for y in range( 0, len ( seq)):
c=(seq[y:y+3])
#print(c)
for k, v in dict.items():
if seq[y:y+3] == k:
alle_amino = v[::3] #alle aminozuren op rijtje, a1.1 -a2.1- a.3.1-a1.2 enzo
print (v)
With this script I get the amino acids from the 3 frames under each other, but how can I sort this and get all the amino acids from frame 1 next to each other, and all the amino acids from frame 2 next to each other, and the same for frame 3?
for example , my results must be :
+3 SerIleLeuAlaStpProLysTrpGluProProTyrValAlaStpProIleTyrIleTyrTle
+2 PheAsnThrSerMetThrLysValGlyThrProLeuArgSerMetThrHisIleTyrIleTyr
+1 PheGlnTyrStpHisAspGlnSerGlyAsnProLeuThrStpHisAspProTyrIleTyrIle
TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA
I use Python 3.
i had one more question : can i make this results by some changes in mine own script ?
You can use (Note this would be ridiculously much more easier using biopython translate method):
Note I changed the name of your dictionary with
dicti(not to overwritedict).Some comments to help you understand:
translatetakes you sequence and returns it in the form of a list in which each item corresponds to the amino acid translation of the triplet coding that position. Like:you could process more this data (get only one or three letters code) inside
translateor return it as it is to be processed latter as I have done.translateis called infor each frame. For frame value being 0, 1 or 2 it sends seq[frame:] as a parameter to translate. That is, you are sending the sequences corresponding to the three different reading frames processing them in series. Then, in
I split the one and three-letters codes for each amino acid and take the one at index 1 (the second). Then they are joined in a single string