Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 6999125
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 27, 20262026-05-27T20:30:02+00:00 2026-05-27T20:30:02+00:00

I have to write a script to translate this sequence: dict = {TTT:F|Phe,TTC:F|Phe,TTA:L|Leu,TTG:L|Leu,TCT:S|Ser,TCC:S|Ser, TCA:S|Ser,TCG:S|Ser,

  • 0

I have to write a script to translate this sequence:

dict = {"TTT":"F|Phe","TTC":"F|Phe","TTA":"L|Leu","TTG":"L|Leu","TCT":"S|Ser","TCC":"S|Ser",
              "TCA":"S|Ser","TCG":"S|Ser", "TAT":"Y|Tyr","TAC":"Y|Tyr","TAA":"*|Stp","TAG":"*|Stp",
              "TGT":"C|Cys","TGC":"C|Cys","TGA":"*|Stp","TGG":"W|Trp", "CTT":"L|Leu","CTC":"L|Leu",
              "CTA":"L|Leu","CTG":"L|Leu","CCT":"P|Pro","CCC":"P|Pro","CCA":"P|Pro","CCG":"P|Pro",
              "CAT":"H|His","CAC":"H|His","CAA":"Q|Gln","CAG":"Q|Gln","CGT":"R|Arg","CGC":"R|Arg",
              "CGA":"R|Arg","CGG":"R|Arg", "ATT":"I|Ile","ATC":"I|Ile","ATA":"I|Ile","ATG":"M|Met",
              "ACT":"T|Thr","ACC":"T|Thr","ACA":"T|Thr","ACG":"T|Thr", "AAT":"N|Asn","AAC":"N|Asn",
              "AAA":"K|Lys","AAG":"K|Lys","AGT":"S|Ser","AGC":"S|Ser","AGA":"R|Arg","AGG":"R|Arg",
              "GTT":"V|Val","GTC":"V|Val","GTA":"V|Val","GTG":"V|Val","GCT":"A|Ala","GCC":"A|Ala",
              "GCA":"A|Ala","GCG":"A|Ala", "GAT":"D|Asp","GAC":"D|Asp","GAA":"E|Glu",
              "GAG":"E|Glu","GGT":"G|Gly","GGC":"G|Gly","GGA":"G|Gly","GGG":"G|Gly"}

seq = "TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA"
a=""

for y in range( 0, len ( seq)):
    c=(seq[y:y+3])
    #print(c)
    for  k, v in dict.items():
        if seq[y:y+3] == k:
            alle_amino = v[::3] #alle aminozuren op rijtje, a1.1 -a2.1- a.3.1-a1.2 enzo
            print (v)

With this script I get the amino acids from the 3 frames under each other, but how can I sort this and get all the amino acids from frame 1 next to each other, and all the amino acids from frame 2 next to each other, and the same for frame 3?

for example , my results must be :

+3 SerIleLeuAlaStpProLysTrpGluProProTyrValAlaStpProIleTyrIleTyrTle

+2 PheAsnThrSerMetThrLysValGlyThrProLeuArgSerMetThrHisIleTyrIleTyr

+1 PheGlnTyrStpHisAspGlnSerGlyAsnProLeuThrStpHisAspProTyrIleTyrIle

TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA

I use Python 3.

i had one more question : can i make this results by some changes in mine own script ?

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-27T20:30:03+00:00Added an answer on May 27, 2026 at 8:30 pm

    You can use (Note this would be ridiculously much more easier using biopython translate method):

    dictio = {your dictionary here}
    
    def translate(seq):
        x = 0
        aaseq = []
        while True:
            try:
                aaseq.append(dicti[seq[x:x+3]])
                x += 3
            except (IndexError, KeyError):
                break
        return aaseq
    
    seq = "TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA"
    
    for frame in range(3):
        print('+%i' %(frame+1), ''.join(item.split('|')[1] for item in translate(seq[frame:])))
    

    Note I changed the name of your dictionary with dicti (not to overwrite dict).


    Some comments to help you understand:

    translate takes you sequence and returns it in the form of a list in which each item corresponds to the amino acid translation of the triplet coding that position. Like:

    aaseq = ["L|Leu","L|Leu","P|Pro", ....]
    

    you could process more this data (get only one or three letters code) inside translate or return it as it is to be processed latter as I have done.

    translate is called in

    ''.join(item.split('|')[1] for item in translate(seq[frame:]))
    

    for each frame. For frame value being 0, 1 or 2 it sends seq[frame:] as a parameter to translate. That is, you are sending the sequences corresponding to the three different reading frames processing them in series. Then, in

       ''.join(item.split('|')[1]
    

    I split the one and three-letters codes for each amino acid and take the one at index 1 (the second). Then they are joined in a single string

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have to write a script which will be hosted on differents domains. This
I have to write a Matlab script that does this: The input is 2
I have write a script for renaming it is like this for i in
I am not too familiar with python and have to write a script to
I have to write a Perl script to convert an XML file into a
I have to write a bash script that makes lot of things. I'd like
Is Delphi have any ability to write script of IDE actions? I would like
I have been asked to write a script that pulls the latest code from
i write a script and it works perfectly, on my local server. I have
I have a noobie question: I need to write SQL script that returns 3

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.