Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 3635110
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 19, 20262026-05-19T00:51:47+00:00 2026-05-19T00:51:47+00:00

I have written the below code for LCS. It works for many cases but

  • 0

I have written the below code for LCS. It works for many cases but breaks for the one below. I do not understand where my code is breaking. Please help. The code is in C#

namespace LongestCommonSubsequenceBF
{
class Program
{
    static void Main(string[] args)
    {

        string B = "AAACCGTGAGTTATTCGTTCTAGAA";
        string A = "CACCCCTAAGGTACCTTTGGTTC";
        //find LCS in A,B starting from index 0 of each
        int longestCommonSubsequence = LCS(A, B, 0, 0);
        Console.WriteLine(longestCommonSubsequence);
        Console.Read();

    }

    //Find the longest common subsequnce starting from index1 in A and index2 in B
    //Pass A as shorter string
    public static int LCS(String A, String B, int index1, int index2)
    {
        int max = 0;
        if (index1 == A.Length)
        {
            //You have reached beyond A and thus no subsequence
            return 0;
        }
        if (index2 == B.Length)
        {   //you may reach end of 2nd string. LCS from that end is 0
            return 0;
        }

        for (int i = index1; i < A.Length ; i++)
        {
            int exist = B.IndexOf(A[i],index2);
            if (exist != -1)
            {
             //   found = true;

                int temp = 1 + LCS(A, B, i + 1, exist + 1);
                if (max < temp)
                {
                    max = temp;
                }


            }


        }
        return max;

    }
  }
}
  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-19T00:51:47+00:00Added an answer on May 19, 2026 at 12:51 am

    Why do you think your algorithm is broken? The longest common subsequence is ACCTAGTATTGTTC, which is 14 characters long:

    string B = "AAACCGTGAGTTATTCGTTCTAGAA";
                  ^^^ ^ ^^ ^^^^ ^^^^
    
    string A = "CACCCCTAAGGTACCTTTGGTTC";
                 ^^^  ^ ^^ ^^  ^^ ^ ^^^
    

    (I modified your algorithm to return the sequence instead of just the length.)

    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

I have written below code to check for blank value in my textbox but
I have written code below.but it will print this exception and i really don't
I have written is code below, but button isn't shown because i've set FILL_PARENT
I have written the code below for a login page, but doesn't seem to
I have written a very simple WCF service, that worked fine (code below), then
I have written an autogenerating sitemap code below, it is called every 12 hours.
I am have written the following code below to encode a bitarray into custom
I have written the code below, and it complains the the method defineProperty does
I have written the code below to generate a matrix containing what is, to
I have written the code below for adding products to a basket, then outputting

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.