Sign Up

Sign Up to our social questions and Answers Engine to ask questions, answer people’s questions, and connect with other people.

Have an account? Sign In

Have an account? Sign In Now

Sign In

Login to our social questions & Answers Engine to ask questions answer people’s questions & connect with other people.

Sign Up Here

Forgot Password?

Don't have account, Sign Up Here

Forgot Password

Lost your password? Please enter your email address. You will receive a link and will create a new password via email.

Have an account? Sign In Now

You must login to ask a question.

Forgot Password?

Need An Account, Sign Up Here

Please briefly explain why you feel this question should be reported.

Please briefly explain why you feel this answer should be reported.

Please briefly explain why you feel this user should be reported.

Sign InSign Up

The Archive Base

The Archive Base Logo The Archive Base Logo

The Archive Base Navigation

  • SEARCH
  • Home
  • About Us
  • Blog
  • Contact Us
Search
Ask A Question

Mobile menu

Close
Ask a Question
  • Home
  • Add group
  • Groups page
  • Feed
  • User Profile
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Buy Points
  • Users
  • Help
  • Buy Theme
  • SEARCH
Home/ Questions/Q 3322178
In Process

The Archive Base Latest Questions

Editorial Team
  • 0
Editorial Team
Asked: May 17, 20262026-05-17T23:09:04+00:00 2026-05-17T23:09:04+00:00

Imagine we have a long string containing the substrings ‘cat’ and ‘dog’ as well

  • 0

Imagine we have a long string containing the substrings ‘cat’ and ‘dog’ as well as other random characters, eg.

cat x dog cat x cat x dog x dog x cat x dog x cat

Here ‘x’ represents any random sequence of characters (but not ‘cat’ or ‘dog’).

What I want to do is find every ‘cat’ that is followed by any characters except ‘dog’ and then by ‘cat’. I want to remove that first instance of ‘cat’ in each case.

In this case, I would want to remove the bracketed [cat] because there is no ‘dog’ after it before the next ‘cat’:

cat x dog [cat] x cat x dog x dog x cat x dog x cat

To end up with:

cat x dog x cat x dog x dog x cat x dog x cat

How can this be done?

I thought of somehow using a regular expression like (n)(?=(n)) as VonC recommended
here

(cat)(?=(.*cat))

to match all of the pairs of ‘cat’ in the string. But I am still not sure how I could use this to remove each cat that is not followed by ‘dog’ before ‘cat’.


The real problem I am tackling is in Java. But I am really just looking for a general pseudocode/regex solution.

  • 1 1 Answer
  • 0 Views
  • 0 Followers
  • 0
Share
  • Facebook
  • Report

Leave an answer
Cancel reply

You must login to add an answer.

Forgot Password?

Need An Account, Sign Up Here

1 Answer

  • Voted
  • Oldest
  • Recent
  • Random
  1. Editorial Team
    Editorial Team
    2026-05-17T23:09:04+00:00Added an answer on May 17, 2026 at 11:09 pm

    Is there any particular reason you want to do this with just one RE call? I’m not sure if that’s actually possible in one RE.

    If I had to do this, I’d probably go in two passes. First mark each instance of ‘cat’ and ‘dog’ in the string, then write some code to identify which cats need to be removed, and do that in another pass.

    Pseudocode follows:

    // Find all the cats and dogs
    int[] catLocations = string.findIndex(/cat/);
    int[] dogLocations = string.findIndex(/dog/);
    int [] idsToRemove = doLogic(catLocations, dogLocations);
    
    // Remove each identified cat, from the end to the front
    for (int id : idsToRemove.reverse())
      string.removeSubstring(id, "cat".length());
    
    • 0
    • Reply
    • Share
      Share
      • Share on Facebook
      • Share on Twitter
      • Share on LinkedIn
      • Share on WhatsApp
      • Report

Sidebar

Related Questions

Imagine a long string of characters: AATTAATCTATATATTGAAATGGGGCCCCAATTTTCCCAAATC .... I define 4 strings: AAT ATG
Imagine you have an entity that has some relations with other entities and you
Imagine I have a string - something like this: This is some really cool
Imagine you have a very long sequence. What is the most efficient way of
Imagine you have the following TreeMap: var dates = new TreeMap[Long, Tuple2[Int, Double]]() I
Imagine I have a table which stores a series of sparse vectors. A sparse
Imagine I have a method: void Method(bool parameter){ if(parameter){ // first case } else
Imagine you have a large dataset that may or may not be filtered by
imagine I have a bunch of C++ related classes (all extending the same base
Imagine I have this code: var myFunc1 = function(event) { alert(1); } var myFunc2

Explore

  • Home
  • Add group
  • Groups page
  • Communities
  • Questions
    • New Questions
    • Trending Questions
    • Must read Questions
    • Hot Questions
  • Polls
  • Tags
  • Badges
  • Users
  • Help
  • SEARCH

Footer

© 2021 The Archive Base. All Rights Reserved
With Love by The Archive Base

Insert/edit link

Enter the destination URL

Or link to existing content

    No search term specified. Showing recent items. Search or use up and down arrow keys to select an item.